Transcript: Mouse XR_388347.3

PREDICTED: Mus musculus glial fibrillary acidic protein (Gfap), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gfap (14580)
Length:
2323
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388347.3
NBCI Gene record:
Gfap (14580)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090603 GAGAGAGATTCGCACTCAATA pLKO.1 707 3UTR 100% 13.200 18.480 N Gfap n/a
2 TRCN0000437350 AGCACGAAGCTAACGACTATC pLKO_005 838 3UTR 100% 10.800 15.120 N Gfap n/a
3 TRCN0000427385 GAACAACCTGGCTGCGTATAG pLKO_005 500 3UTR 100% 10.800 15.120 N Gfap n/a
4 TRCN0000090605 GAGTGGTATCGGTCTAAGTTT pLKO.1 765 3UTR 100% 5.625 7.875 N Gfap n/a
5 TRCN0000090607 GATCTACTCAACGTTAAGCTA pLKO.1 1053 3UTR 100% 3.000 4.200 N Gfap n/a
6 TRCN0000090604 TCGTGTGGATTTGGAGAGAAA pLKO.1 548 3UTR 100% 4.950 3.465 N Gfap n/a
7 TRCN0000090606 CTTTGCTAGCTACATCGAGAA pLKO.1 239 3UTR 100% 4.050 2.835 N Gfap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.