Transcript: Mouse XR_388465.3

PREDICTED: Mus musculus golgi associated, gamma adaptin ear containing, ARF binding protein 3 (Gga3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gga3 (260302)
Length:
3612
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388465.3
NBCI Gene record:
Gga3 (260302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362409 ACACCCTGAACAGCGTTTATA pLKO_005 2212 3UTR 100% 15.000 21.000 N Gga3 n/a
2 TRCN0000362489 ATAAGAGGCGGACGCTGTTTA pLKO_005 815 3UTR 100% 13.200 18.480 N Gga3 n/a
3 TRCN0000115307 GCTTCGATATAAACTGACCTT pLKO.1 2038 3UTR 100% 2.640 3.696 N Gga3 n/a
4 TRCN0000362490 TTGAAGGGCAGATCGTCAATG pLKO_005 935 3UTR 100% 10.800 8.640 N Gga3 n/a
5 TRCN0000362408 TCTGGGCCCAGAGTAGGATTT pLKO_005 2408 3UTR 100% 10.800 7.560 N Gga3 n/a
6 TRCN0000115306 CCCTGTAAGAACTGCATCTTT pLKO.1 2489 3UTR 100% 5.625 3.938 N Gga3 n/a
7 TRCN0000065022 GCCCAAGTCAATGAAAGTGAA pLKO.1 1909 3UTR 100% 4.950 3.465 N GGA3 n/a
8 TRCN0000115309 GCCGGAAGAAGCAAAGATCAA pLKO.1 420 3UTR 100% 4.950 3.465 N Gga3 n/a
9 TRCN0000115308 GCTTCACTACAGCCAAGAGTA pLKO.1 741 3UTR 100% 4.950 3.465 N Gga3 n/a
10 TRCN0000115310 CAGATCAACAAAGAGCTTGAA pLKO.1 148 3UTR 100% 4.950 2.970 N Gga3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.