Transcript: Mouse XR_388466.3

PREDICTED: Mus musculus acyl-CoA synthetase family member 2 (Acsf2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acsf2 (264895)
Length:
1270
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388466.3
NBCI Gene record:
Acsf2 (264895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443471 CCTATGCCTGGGTACTTATTC pLKO_005 521 3UTR 100% 13.200 18.480 N Acsf2 n/a
2 TRCN0000099491 CCCACGATGTTTGTGGATATT pLKO.1 1031 3UTR 100% 13.200 10.560 N Acsf2 n/a
3 TRCN0000099492 ACCCTGCTCCTGGATGATATT pLKO.1 796 3UTR 100% 13.200 9.240 N Acsf2 n/a
4 TRCN0000099494 GCTTTGGTTATCCTCCATGAA pLKO.1 388 3UTR 100% 4.950 3.465 N Acsf2 n/a
5 TRCN0000416901 TGGTAGTGTGGGCAGAATTAT pLKO_005 1252 3UTR 100% 15.000 10.500 N Acsf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.