Transcript: Mouse XR_390753.1

PREDICTED: Mus musculus leucine zipper protein 1 (Luzp1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Luzp1 (269593)
Length:
3825
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_390753.1
NBCI Gene record:
Luzp1 (269593)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_390753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249349 GAACTAGAACTGCCCTATTTG pLKO_005 2508 3UTR 100% 13.200 18.480 N Luzp1 n/a
2 TRCN0000249345 TACGGATAGAGGACGGCATTT pLKO_005 1131 3UTR 100% 10.800 15.120 N Luzp1 n/a
3 TRCN0000249346 TGCGGTCTAGAGCAATTATAA pLKO_005 2661 3UTR 100% 15.000 10.500 N Luzp1 n/a
4 TRCN0000216184 CAGAAACGAATGGTTGATTTA pLKO.1 749 3UTR 100% 13.200 9.240 N Luzp1 n/a
5 TRCN0000175557 CCACCTCTAAATCTGTGACAA pLKO.1 2760 3UTR 100% 4.950 3.465 N Luzp1 n/a
6 TRCN0000249347 CAACCGCCACCTGCGATTTAA pLKO_005 445 3UTR 100% 15.000 9.000 N Luzp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_390753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.