Transcript: Mouse XR_391103.2

PREDICTED: Mus musculus centrosomal protein 89 (Cep89), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep89 (72140)
Length:
1818
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_391103.2
NBCI Gene record:
Cep89 (72140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_391103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216369 GATGATTGTCCATCGATTGAA pLKO.1 1125 3UTR 100% 5.625 7.875 N Cep89 n/a
2 TRCN0000178483 GCTGGTAGAATACATCAAAGA pLKO.1 841 3UTR 100% 4.950 6.930 N Cep89 n/a
3 TRCN0000277554 GCTGGTAGAATACATCAAAGA pLKO_005 841 3UTR 100% 4.950 6.930 N Cep89 n/a
4 TRCN0000285973 CACCCTGGTTGGTGGATATAA pLKO_005 1238 3UTR 100% 15.000 12.000 N Cep89 n/a
5 TRCN0000285975 GAGCCGAGAAGGACGTCATTA pLKO_005 490 3UTR 100% 13.200 9.240 N Cep89 n/a
6 TRCN0000277482 TTGCACCAAGAGTTAACTAAG pLKO_005 1390 3UTR 100% 10.800 7.560 N Cep89 n/a
7 TRCN0000176663 CTGGTAGAATACATCAAAGAT pLKO.1 842 3UTR 100% 5.625 3.938 N Cep89 n/a
8 TRCN0000200362 GAGACAGGCAATGAAGGACTT pLKO.1 960 3UTR 100% 4.050 2.835 N Cep89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_391103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.