Transcript: Human XR_427802.3

PREDICTED: Homo sapiens zinc finger protein 346 (ZNF346), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF346 (23567)
Length:
2818
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_427802.3
NBCI Gene record:
ZNF346 (23567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_427802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219819 CCATGGAATGGAGACATTAAA pLKO.1 443 3UTR 100% 15.000 21.000 N ZNF346 n/a
2 TRCN0000240712 TTTGCTGCGCCTTGCTTATTT pLKO_005 352 3UTR 100% 15.000 21.000 N ZNF346 n/a
3 TRCN0000240714 ATGGGAGCTTGGAGCTAATAC pLKO_005 1137 3UTR 100% 13.200 18.480 N ZNF346 n/a
4 TRCN0000219820 CTCATTGGTCCGGGCTAATTC pLKO.1 817 3UTR 100% 13.200 18.480 N ZNF346 n/a
5 TRCN0000099259 AGTGAAGAGATACCTAGCAAT pLKO.1 422 3UTR 100% 4.950 3.960 N Zfp346 n/a
6 TRCN0000316265 AGTGAAGAGATACCTAGCAAT pLKO_005 422 3UTR 100% 4.950 3.960 N Zfp346 n/a
7 TRCN0000240715 TCCCAGAAGCTGGCACATTAC pLKO_005 378 3UTR 100% 10.800 7.560 N ZNF346 n/a
8 TRCN0000179045 CCAGAAGAACCAATGTCTCTT pLKO.1 311 3UTR 100% 4.950 3.465 N ZNF346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_427802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.