Transcript: Human XR_429076.2

PREDICTED: Homo sapiens methyl-CpG binding domain protein 6 (MBD6), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBD6 (114785)
Length:
3649
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_429076.2
NBCI Gene record:
MBD6 (114785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_429076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038785 CCCTACCCTCATAGCTTTAAA pLKO.1 2270 3UTR 100% 15.000 21.000 N MBD6 n/a
2 TRCN0000229917 CCCTACCCTCATAGCTTTAAA pLKO_005 2270 3UTR 100% 15.000 21.000 N MBD6 n/a
3 TRCN0000229916 TTGCTCAACCACAGTTTATTT pLKO_005 1923 3UTR 100% 15.000 21.000 N MBD6 n/a
4 TRCN0000257307 GGTCTGGAGTGTCCACTTAAT pLKO_005 447 3UTR 100% 13.200 18.480 N MBD6 n/a
5 TRCN0000336147 GGTCTGGAGTGTCCACTTAAT pLKO_005 447 3UTR 100% 13.200 18.480 N Mbd6 n/a
6 TRCN0000038788 CCACAGTTTATTTGGTGTGCT pLKO.1 1931 3UTR 100% 2.640 3.696 N MBD6 n/a
7 TRCN0000038786 CCTCCTACAACTCCACTTAAT pLKO.1 714 3UTR 100% 13.200 9.240 N MBD6 n/a
8 TRCN0000229915 CCTCCTACAACTCCACTTAAT pLKO_005 714 3UTR 100% 13.200 9.240 N MBD6 n/a
9 TRCN0000038787 TGGTGGCTTCAATGGACAAAT pLKO.1 2951 3UTR 100% 13.200 9.240 N MBD6 n/a
10 TRCN0000038784 CCTACTGTATTTCGATTGCTA pLKO.1 1368 3UTR 100% 3.000 2.100 N MBD6 n/a
11 TRCN0000178114 GCTCAGTTTACAAACCTGTGA pLKO.1 3378 3UTR 100% 2.640 1.848 N Mbd6 n/a
12 TRCN0000336096 CCTCCTACAACTCCACTTAAC pLKO_005 714 3UTR 100% 10.800 7.560 N Mbd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_429076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.