Transcript: Human XR_429299.3

PREDICTED: Homo sapiens sec1 family domain containing 1 (SCFD1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCFD1 (23256)
Length:
2069
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_429299.3
NBCI Gene record:
SCFD1 (23256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_429299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183077 CTACTTGGAATGTGGATAAAT pLKO.1 1899 3UTR 100% 15.000 21.000 N SCFD1 n/a
2 TRCN0000418810 ATCTACCTGTTACTCGTATTT pLKO_005 1575 3UTR 100% 13.200 18.480 N SCFD1 n/a
3 TRCN0000420263 GATGAGGTCAAACGACTTAAA pLKO_005 1081 3UTR 100% 13.200 10.560 N SCFD1 n/a
4 TRCN0000093306 CCAGTATGGAAGGTACTCATT pLKO.1 145 3UTR 100% 4.950 3.960 N Scfd1 n/a
5 TRCN0000324373 CCAGTATGGAAGGTACTCATT pLKO_005 145 3UTR 100% 4.950 3.960 N Scfd1 n/a
6 TRCN0000415207 AGCTTCCAGAGGCCCTTATTA pLKO_005 778 3UTR 100% 15.000 10.500 N SCFD1 n/a
7 TRCN0000428780 CAGTATGGAAGGTACTCATTT pLKO_005 146 3UTR 100% 13.200 9.240 N SCFD1 n/a
8 TRCN0000183720 CAGAAGAACCTTACTATGATA pLKO.1 1876 3UTR 100% 5.625 3.938 N SCFD1 n/a
9 TRCN0000146271 CTTGTTTCATATCGTGCCATT pLKO.1 532 3UTR 100% 4.050 2.835 N SCFD1 n/a
10 TRCN0000183046 CTTTACATCATACTTGGACAT pLKO.1 833 3UTR 100% 4.050 2.835 N SCFD1 n/a
11 TRCN0000148168 GAATCAGTTCAGCAAGAACTA pLKO.1 1039 3UTR 100% 0.495 0.347 N SCFD1 n/a
12 TRCN0000093308 GAAACTGTTATGGACACTATT pLKO.1 583 3UTR 100% 13.200 9.240 N Scfd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_429299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.