Transcript: Human XR_430492.1

PREDICTED: Homo sapiens TGF-beta activated kinase 1 (MAP3K7) binding protein 3 (TAB3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAB3 (257397)
Length:
8254
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_430492.1
NBCI Gene record:
TAB3 (257397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_430492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011194 GCGGTTGAAGTCTGAAGTTAA pLKO.1 2283 3UTR 100% 13.200 18.480 N TAB3 n/a
2 TRCN0000378448 ACATGCACATACCTCGGTATA pLKO_005 1211 3UTR 100% 10.800 15.120 N Tab3 n/a
3 TRCN0000368321 CACTATAGCCAGCGTCCTTTA pLKO_005 1438 3UTR 100% 10.800 15.120 N TAB3 n/a
4 TRCN0000364080 TGGTCGAACACTGGTACATAG pLKO_005 942 3UTR 100% 10.800 8.640 N TAB3 n/a
5 TRCN0000364082 CCATACACAGCATCTAGTTTA pLKO_005 1714 3UTR 100% 13.200 9.240 N TAB3 n/a
6 TRCN0000011196 GCCTGAGGAAATGACAAGATT pLKO.1 2370 3UTR 100% 5.625 3.938 N TAB3 n/a
7 TRCN0000011193 CCTCCTTCATACATGCACATA pLKO.1 1201 3UTR 100% 4.950 3.465 N TAB3 n/a
8 TRCN0000011195 CCCAACTTAATGGTGGTCGAA pLKO.1 929 3UTR 100% 2.640 1.848 N TAB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_430492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.