Transcript: Human XR_430519.3

PREDICTED: Homo sapiens bromodomain and WD repeat domain containing 3 (BRWD3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRWD3 (254065)
Length:
4958
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_430519.3
NBCI Gene record:
BRWD3 (254065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_430519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378280 GTAGTCGCTTTGGTCATATTT pLKO_005 729 3UTR 100% 15.000 21.000 N BRWD3 n/a
2 TRCN0000226212 TGATAGATTCCGCAGTATAAT pLKO_005 3418 3UTR 100% 15.000 21.000 N Brwd3 n/a
3 TRCN0000359014 TGATAGATTCCGCAGTATAAT pLKO_005 3418 3UTR 100% 15.000 21.000 N BRWD3 n/a
4 TRCN0000364192 TCGAAGACATAGTAGTCAAAT pLKO_005 2359 3UTR 100% 13.200 18.480 N BRWD3 n/a
5 TRCN0000432687 ACAAGACCTGAGACTAATTAA pLKO_005 2236 3UTR 100% 15.000 10.500 N BRWD3 n/a
6 TRCN0000136866 CCCAGGGAAAGCCAAATCATT pLKO.1 4790 3UTR 100% 5.625 3.938 N BRWD3 n/a
7 TRCN0000159299 GACAACAAGATTCATCTCTTT pLKO.1 4320 3UTR 100% 4.950 3.465 N BRWD3 n/a
8 TRCN0000159352 GCAACAAGAATGGAAGAGTAT pLKO.1 1447 3UTR 100% 4.950 3.465 N BRWD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_430519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.