Transcript: Mouse XR_866209.2

PREDICTED: Mus musculus a disintegrin and metallopeptidase domain 33 (Adam33), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adam33 (110751)
Length:
2990
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_866209.2
NBCI Gene record:
Adam33 (110751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_866209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032363 CACACGGATCATTGCCAATAT pLKO.1 388 3UTR 100% 13.200 10.560 N Adam33 n/a
2 TRCN0000032362 GTGACTATGGACTCCACAATT pLKO.1 1740 3UTR 100% 13.200 9.240 N Adam33 n/a
3 TRCN0000032361 CTCCCAATACAAAGCAGGAAT pLKO.1 609 3UTR 100% 4.950 3.465 N Adam33 n/a
4 TRCN0000032360 GCCATGTTTCCAGCAGATGAA pLKO.1 1586 3UTR 100% 4.950 3.465 N Adam33 n/a
5 TRCN0000032359 GCTCGGATGTTTCCAGGAAAT pLKO.1 142 3UTR 100% 10.800 6.480 N Adam33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_866209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.