Transcript: Mouse XR_866344.2

PREDICTED: Mus musculus secernin 3 (Scrn3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scrn3 (74616)
Length:
1253
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_866344.2
NBCI Gene record:
Scrn3 (74616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_866344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346428 AGTCCAAGGCGTTCGTAATAT pLKO_005 771 3UTR 100% 15.000 21.000 N Scrn3 n/a
2 TRCN0000346352 ACGTCTCAAGTGTACTTATAT pLKO_005 390 3UTR 100% 15.000 12.000 N Scrn3 n/a
3 TRCN0000346426 ACAGTAGGAAATAGGGTTATT pLKO_005 286 3UTR 100% 13.200 9.240 N Scrn3 n/a
4 TRCN0000346427 GATGAAGTACAAGAAGTAATT pLKO_005 334 3UTR 100% 13.200 9.240 N Scrn3 n/a
5 TRCN0000216839 GGCAAAGAGTTCAGCTATTAC pLKO.1 676 3UTR 100% 13.200 9.240 N Scrn3 n/a
6 TRCN0000174632 GATGTCATTGTTGACTTACTA pLKO.1 622 3UTR 100% 5.625 3.938 N Scrn3 n/a
7 TRCN0000194464 GCATTGGGAATGAGGCTGTAT pLKO.1 506 3UTR 100% 4.950 3.465 N Scrn3 n/a
8 TRCN0000175015 GCAGTTCATAATGATTTGGAA pLKO.1 367 3UTR 100% 3.000 2.100 N Scrn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_866344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.