Transcript: Mouse XR_867244.2

PREDICTED: Mus musculus DEP domain containing 1a (Depdc1a), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Depdc1a (76131)
Length:
2250
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_867244.2
NBCI Gene record:
Depdc1a (76131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_867244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328643 AGTTTGGAGATACGTTATTAT pLKO_005 670 3UTR 100% 15.000 21.000 N Depdc1a n/a
2 TRCN0000215836 CCAAGTAATTCCTCAATATAT pLKO.1 748 3UTR 100% 15.000 21.000 N Depdc1a n/a
3 TRCN0000183808 CCAAGAAGTAATGACACCAAT pLKO.1 878 3UTR 100% 4.950 6.930 N Depdc1a n/a
4 TRCN0000184009 CGGAGAGTCTAGTACCACAAT pLKO.1 1744 3UTR 100% 4.950 3.960 N Depdc1a n/a
5 TRCN0000183862 CCATAGAACTTTCAGAGAAAT pLKO.1 1788 3UTR 100% 13.200 9.240 N Depdc1a n/a
6 TRCN0000328646 CCTGCAACTTCTCCACTTAAA pLKO_005 422 3UTR 100% 13.200 9.240 N Depdc1a n/a
7 TRCN0000180737 GCACCTGACAACCAAGAAATA pLKO.1 629 3UTR 100% 13.200 9.240 N Depdc1a n/a
8 TRCN0000328645 TGATGACAACAATCAACTATT pLKO_005 394 3UTR 100% 13.200 9.240 N Depdc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_867244.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.