Transcript: Mouse XR_868206.1

PREDICTED: Mus musculus predicted gene 9758 (Gm9758), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm9758 (381714)
Length:
1310
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868206.1
NBCI Gene record:
Gm9758 (381714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284246 CTCACTACCGAGGAGACAAAT pLKO_005 546 3UTR 100% 13.200 6.600 Y Gm10220 n/a
2 TRCN0000255101 GAGAAGGAGATCATGACATTT pLKO_005 663 3UTR 100% 13.200 6.600 Y Speer4e n/a
3 TRCN0000248369 GCTCAAGAAGGAGACACATTT pLKO_005 734 3UTR 100% 13.200 6.600 Y Speer4d n/a
4 TRCN0000179250 GAGACAAATGAGCTGAGAGAT pLKO.1 558 3UTR 100% 4.950 2.475 Y Gm9758 n/a
5 TRCN0000183327 GATCATGACATTTCTACACAA pLKO.1 671 3UTR 100% 4.950 2.475 Y Gm9758 n/a
6 TRCN0000176051 GCAGTTTGAGAAGGAAGAGAA pLKO.1 503 3UTR 100% 4.950 2.475 Y Speer4d n/a
7 TRCN0000183289 GTCATAAGCAAGAAGCAGTTT pLKO.1 489 3UTR 100% 4.950 2.475 Y Gm9758 n/a
8 TRCN0000270314 GAGAAGGAGATCATGACATAT pLKO_005 663 3UTR 100% 13.200 6.600 Y Gm10220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.