Transcript: Mouse XR_868675.1

PREDICTED: Mus musculus cytochrome P450, family 3, subfamily a, polypeptide 44 (Cyp3a44), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cyp3a44 (337924)
Length:
1671
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868675.1
NBCI Gene record:
Cyp3a44 (337924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216331 GCATTGATCCTTACGTATATC pLKO.1 1382 3UTR 100% 13.200 7.920 N Cyp3a44 n/a
2 TRCN0000255997 GTGATCACCAGCACATCATTT pLKO_005 649 3UTR 100% 13.200 6.600 Y Cyp3a41b n/a
3 TRCN0000193631 CCAAAGACAAAGACTCTCATA pLKO.1 947 3UTR 100% 4.950 2.475 Y Cyp3a44 n/a
4 TRCN0000126583 CCTCTGAAATTAAGCAGACAA pLKO.1 1615 3UTR 100% 4.950 2.475 Y Cyp3a41a n/a
5 TRCN0000193782 CCTCTGAAATTAAGCAGACAA pLKO.1 1615 3UTR 100% 4.950 2.475 Y Cyp3a44 n/a
6 TRCN0000193999 GCTTAATGAAACCCTCAGATT pLKO.1 1182 3UTR 100% 4.950 2.475 Y Cyp3a44 n/a
7 TRCN0000174743 GTCTGTAAGAAAGATGTTGAA pLKO.1 1231 3UTR 100% 4.950 2.475 Y Cyp3a44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.