Transcript: Mouse XR_868875.3

PREDICTED: Mus musculus solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26 (Slc25a26), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Slc25a26 (67582)
Length:
824
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868875.3
NBCI Gene record:
Slc25a26 (67582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070044 CACGGACTCTACTTCACACTT pLKO.1 361 3UTR 100% 4.950 3.960 N Slc25a26 n/a
2 TRCN0000317479 CACGGACTCTACTTCACACTT pLKO_005 361 3UTR 100% 4.950 3.960 N Slc25a26 n/a
3 TRCN0000070047 CTCTGTGGACTTGATATTATT pLKO.1 178 3UTR 100% 15.000 10.500 N Slc25a26 n/a
4 TRCN0000349941 GGACTGTACCGAGGCTATAAA pLKO_005 539 3UTR 100% 15.000 10.500 N Slc25a26 n/a
5 TRCN0000070045 TGGTGGATTTCGTGGGATATA pLKO.1 253 3UTR 100% 13.200 9.240 N Slc25a26 n/a
6 TRCN0000070046 GTTTCCCTTGTGGGAATCCTT pLKO.1 774 3UTR 100% 0.300 0.210 N Slc25a26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.