Transcript: Mouse XR_872208.2

PREDICTED: Mus musculus Fanconi anemia, complementation group L (Fancl), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fancl (67030)
Length:
1593
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_872208.2
NBCI Gene record:
Fancl (67030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_872208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040545 GCTCCTTGGTAGATGTTTATA pLKO.1 571 3UTR 100% 15.000 10.500 N Fancl n/a
2 TRCN0000335379 GCTCCTTGGTAGATGTTTATA pLKO_005 571 3UTR 100% 15.000 10.500 N Fancl n/a
3 TRCN0000040547 CAGCTCAAGAAGGCAAGATTA pLKO.1 168 3UTR 100% 13.200 9.240 N Fancl n/a
4 TRCN0000040546 CCTACCATGCTTCCTGAGTTT pLKO.1 762 3UTR 100% 4.950 3.465 N Fancl n/a
5 TRCN0000363836 CCTACCATGCTTCCTGAGTTT pLKO_005 762 3UTR 100% 4.950 3.465 N Fancl n/a
6 TRCN0000040544 GCACCTAATCACTGTCAAGTT pLKO.1 470 3UTR 100% 4.950 3.465 N Fancl n/a
7 TRCN0000335378 GCACCTAATCACTGTCAAGTT pLKO_005 470 3UTR 100% 4.950 3.465 N Fancl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_872208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.