Transcript: Mouse XR_873437.2

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 (Ddx46), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx46 (212880)
Length:
2793
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_873437.2
NBCI Gene record:
Ddx46 (212880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_873437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176205 GCTGGCTTTACAAATCACTAA pLKO.1 1573 3UTR 100% 4.950 3.960 N Ddx46 n/a
2 TRCN0000345400 GCTGGCTTTACAAATCACTAA pLKO_005 1573 3UTR 100% 4.950 3.960 N Ddx46 n/a
3 TRCN0000175022 GAACAGATTGAAAGCATGTTT pLKO.1 2765 3UTR 100% 5.625 3.938 N Ddx46 n/a
4 TRCN0000345401 GAACAGATTGAAAGCATGTTT pLKO_005 2765 3UTR 100% 5.625 3.938 N Ddx46 n/a
5 TRCN0000193959 GCCCGAAACCAATTAAATCAT pLKO.1 1305 3UTR 100% 5.625 3.938 N Ddx46 n/a
6 TRCN0000345399 GCCCGAAACCAATTAAATCAT pLKO_005 1305 3UTR 100% 5.625 3.938 N Ddx46 n/a
7 TRCN0000001178 GTGATTGTGATTGAAGAAGAA pLKO.1 2111 3UTR 100% 4.950 3.465 N DDX46 n/a
8 TRCN0000279860 GTGATTGTGATTGAAGAAGAA pLKO_005 2111 3UTR 100% 4.950 3.465 N DDX46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_873437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.