Transcript: Mouse XR_874361.1

PREDICTED: Mus musculus methyltransferase like 6 (Mettl6), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl6 (67011)
Length:
1208
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_874361.1
NBCI Gene record:
Mettl6 (67011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_874361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312975 AGATGGAACCAGATCGTATTT pLKO_005 788 3UTR 100% 13.200 18.480 N Mettl6 n/a
2 TRCN0000097556 CCTTGTCTTACTAAACGTGTA pLKO.1 653 3UTR 100% 4.050 5.670 N Mettl6 n/a
3 TRCN0000097557 GCCTTGTCTTACTAAACGTGT pLKO.1 652 3UTR 100% 2.640 3.696 N Mettl6 n/a
4 TRCN0000311952 GCCTTGTCTTACTAAACGTGT pLKO_005 652 3UTR 100% 2.640 3.696 N Mettl6 n/a
5 TRCN0000313020 TCACGCCATGCTTAGATTTAA pLKO_005 728 3UTR 100% 15.000 10.500 N Mettl6 n/a
6 TRCN0000097555 GCAGTTGACTACGTGAAGCAA pLKO.1 489 3UTR 100% 3.000 2.100 N Mettl6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_874361.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.