Transcript: Mouse XR_875266.2

PREDICTED: Mus musculus polycystic kidney and hepatic disease 1-like 1 (Pkhd1l1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkhd1l1 (192190)
Length:
12807
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_875266.2
NBCI Gene record:
Pkhd1l1 (192190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_875266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201348 GCTTCCTATGTTTGGCCTATA pLKO.1 875 3UTR 100% 10.800 8.640 N Pkhd1l1 n/a
2 TRCN0000192518 GCTATCCTAAAGGACTCCAAT pLKO.1 12116 3UTR 100% 4.950 3.960 N Pkhd1l1 n/a
3 TRCN0000201059 CCCAAACTCAATCCAAGGATA pLKO.1 5008 3UTR 100% 4.950 3.465 N Pkhd1l1 n/a
4 TRCN0000192833 GCACAGAACAATTCCTTCCTA pLKO.1 11427 3UTR 100% 3.000 2.100 N Pkhd1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_875266.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.