Transcript: Mouse XR_876129.2

PREDICTED: Mus musculus GA repeat binding protein, alpha (Gabpa), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabpa (14390)
Length:
4985
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_876129.2
NBCI Gene record:
Gabpa (14390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_876129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235697 AGCTTAGTGTACAGGTAATTT pLKO_005 865 3UTR 100% 15.000 21.000 N GABPA n/a
2 TRCN0000304469 AGCTTAGTGTACAGGTAATTT pLKO_005 865 3UTR 100% 15.000 21.000 N Gabpa n/a
3 TRCN0000085296 CGTGCATTACGGTATTATTAT pLKO.1 1719 3UTR 100% 15.000 21.000 N Gabpa n/a
4 TRCN0000316022 CGTGCATTACGGTATTATTAT pLKO_005 1719 3UTR 100% 15.000 21.000 N Gabpa n/a
5 TRCN0000085294 GCCGTGCATTACGGTATTATT pLKO.1 1717 3UTR 100% 15.000 21.000 N Gabpa n/a
6 TRCN0000304421 GCTACACCGACTACGATTAAA pLKO_005 1422 3UTR 100% 15.000 21.000 N Gabpa n/a
7 TRCN0000085295 CCAAGCACATTACGACCATTT pLKO.1 1033 3UTR 100% 10.800 15.120 N Gabpa n/a
8 TRCN0000304420 AGCTAAGCAGTCCTATCAAAT pLKO_005 2420 3UTR 100% 13.200 10.560 N Gabpa n/a
9 TRCN0000235696 ATGAACCAATAGGCAATTTAA pLKO_005 721 3UTR 100% 15.000 10.500 N GABPA n/a
10 TRCN0000304508 ATGAACCAATAGGCAATTTAA pLKO_005 721 3UTR 100% 15.000 10.500 N Gabpa n/a
11 TRCN0000085293 CCTAAGATACAGTTGAACAAA pLKO.1 4143 3UTR 100% 5.625 3.938 N Gabpa n/a
12 TRCN0000085297 CGAGACTGTATTTCTTGGGTT pLKO.1 1599 3UTR 100% 2.640 1.848 N Gabpa n/a
13 TRCN0000235698 ACCTCACCACACTCAACATTT pLKO_005 1219 3UTR 100% 13.200 7.920 N GABPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_876129.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.