Transcript: Mouse XR_876137.2

PREDICTED: Mus musculus dopey family member 2 (Dopey2), transcript variant X21, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dopey2 (70028)
Length:
8728
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_876137.2
NBCI Gene record:
Dopey2 (70028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_876137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097948 CTCAGTAATCGAGAAGGCGTT pLKO.1 240 3UTR 100% 2.160 3.024 N Dopey2 n/a
2 TRCN0000097945 CCTAGAAACCTACGAGATCAT pLKO.1 435 3UTR 100% 4.950 3.960 N Dopey2 n/a
3 TRCN0000097947 CTACGAGATCATCTTCAAGAT pLKO.1 444 3UTR 100% 4.950 3.465 N Dopey2 n/a
4 TRCN0000097946 CGATTACAGATACAGAAGCTA pLKO.1 216 3UTR 100% 3.000 2.100 N Dopey2 n/a
5 TRCN0000097949 CTGAAGTATTCCCTCCTACCA pLKO.1 340 3UTR 100% 2.640 1.848 N Dopey2 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 6708 3UTR 100% 2.640 1.320 Y BC028528 n/a
7 TRCN0000017730 CGTTGGTTTAACAGGAAGAAA pLKO.1 3259 3UTR 100% 5.625 3.938 N DOP1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_876137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.