Transcript: Mouse XR_878034.1

PREDICTED: Mus musculus RIKEN cDNA 4930578C19 gene (4930578C19Rik), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930578C19Rik (75905)
Length:
4672
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_878034.1
NBCI Gene record:
4930578C19Rik (75905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_878034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168214 CCTCGGTCTTGATAAATGCAA pLKO.1 327 3UTR 100% 3.000 4.200 N DIPK2B n/a
2 TRCN0000202479 GCAGGCATGTTTGGCATCTTT pLKO.1 1045 3UTR 100% 5.625 3.938 N 4930578C19Rik n/a
3 TRCN0000192859 GAGGAGCAATGACTTGAACTA pLKO.1 999 3UTR 100% 4.950 3.465 N 4930578C19Rik n/a
4 TRCN0000193023 GCTACACTATGGGAAAGACAT pLKO.1 305 3UTR 100% 4.950 3.465 N 4930578C19Rik n/a
5 TRCN0000191058 CTTGCATTCTTATGCTGCAAA pLKO.1 444 3UTR 100% 0.495 0.347 N 4930578C19Rik n/a
6 TRCN0000173070 CCTGAGCTGTTCTTTCTCCTT pLKO.1 240 3UTR 100% 2.640 1.584 N DIPK2B n/a
7 TRCN0000166885 CTGCAAATTACTCAGATGATT pLKO.1 458 3UTR 100% 5.625 3.938 N DIPK2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_878034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.