Transcript: Mouse XR_878686.2

PREDICTED: Mus musculus ring finger protein, transmembrane 2 (Rnft2), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnft2 (269695)
Length:
3982
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_878686.2
NBCI Gene record:
Rnft2 (269695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_878686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037285 GAATACCATGTACGTCCTTTA pLKO.1 982 3UTR 100% 10.800 7.560 N Rnft2 n/a
2 TRCN0000037288 CAAACTGTGCTTCCAGCACAA pLKO.1 829 3UTR 100% 0.405 0.284 N Rnft2 n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1132 3UTR 100% 4.950 2.475 Y KAAG1 n/a
4 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 1156 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_878686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.