Transcript: Human XR_921907.2

PREDICTED: Homo sapiens pappalysin 2 (PAPPA2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAPPA2 (60676)
Length:
6650
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921907.2
NBCI Gene record:
PAPPA2 (60676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046742 CTCCGGTATCTCTTCACATTT pLKO.1 1812 3UTR 100% 13.200 18.480 N PAPPA2 n/a
2 TRCN0000436412 GGAGCAAGAAATCCATCATAC pLKO_005 1431 3UTR 100% 10.800 15.120 N PAPPA2 n/a
3 TRCN0000046740 CCCAAAGGATACTTGGATCAA pLKO.1 4726 3UTR 100% 4.950 6.930 N PAPPA2 n/a
4 TRCN0000046741 CCTCCTATTAGTGGAGTTGTA pLKO.1 3772 3UTR 100% 4.950 6.930 N PAPPA2 n/a
5 TRCN0000046738 GCCAGCATAATCCACTGATTA pLKO.1 5129 3UTR 100% 1.320 1.056 N PAPPA2 n/a
6 TRCN0000432811 ACCCGTCTTTGGTGAACTATG pLKO_005 5579 3UTR 100% 10.800 7.560 N PAPPA2 n/a
7 TRCN0000046739 CCTGTGTTTGAAGGCATGTAT pLKO.1 5974 3UTR 100% 5.625 3.938 N PAPPA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921907.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.