Transcript: Human XR_922655.2

PREDICTED: Homo sapiens cytidine/uridine monophosphate kinase 2 (CMPK2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMPK2 (129607)
Length:
2300
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922655.2
NBCI Gene record:
CMPK2 (129607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149686 GTCAGTGGCAGATTCACTTAA pLKO.1 927 3UTR 100% 13.200 18.480 N CMPK2 n/a
2 TRCN0000437006 TTGAGGCCAACAGTGTGTTTC pLKO_005 1316 3UTR 100% 10.800 15.120 N CMPK2 n/a
3 TRCN0000429127 ATGAACCAACTATCATTAGAA pLKO_005 1007 3UTR 100% 5.625 7.875 N CMPK2 n/a
4 TRCN0000435942 GCCAAATCTCCTGTGATTGTA pLKO_005 1084 3UTR 100% 5.625 4.500 N CMPK2 n/a
5 TRCN0000146831 CCAGAAGAACATCTCAGATAT pLKO.1 2159 3UTR 100% 13.200 9.240 N CMPK2 n/a
6 TRCN0000419061 CTTTCTTCCTGGCATAGTAAA pLKO_005 1698 3UTR 100% 13.200 9.240 N CMPK2 n/a
7 TRCN0000148610 CAGATCCAGAAAGGAAAGTTC pLKO.1 853 3UTR 100% 4.950 3.465 N CMPK2 n/a
8 TRCN0000149853 CCCAGAAGAACATCTCAGATA pLKO.1 2158 3UTR 100% 4.950 3.465 N CMPK2 n/a
9 TRCN0000436678 GGACTGGATGCCACGGGTAAA pLKO_005 892 3UTR 100% 3.600 2.520 N CMPK2 n/a
10 TRCN0000148334 CAGAAAGGAAAGTTCCAGGTT pLKO.1 859 3UTR 100% 2.640 1.848 N CMPK2 n/a
11 TRCN0000149263 GATCCAGAAAGGAAAGTTCCA pLKO.1 855 3UTR 100% 2.640 1.848 N CMPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.