Transcript: Human XR_922671.1

PREDICTED: Homo sapiens ribonuclease H1 (RNASEH1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNASEH1 (246243)
Length:
2622
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922671.1
NBCI Gene record:
RNASEH1 (246243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049785 CCTGGTCATTCGGGATTTATA pLKO.1 891 3UTR 100% 15.000 10.500 N RNASEH1 n/a
2 TRCN0000307824 CCTGGTCATTCGGGATTTATA pLKO_005 891 3UTR 100% 15.000 10.500 N RNASEH1 n/a
3 TRCN0000303308 ACGATAAATGGTATAACTAAC pLKO_005 747 3UTR 100% 10.800 7.560 N RNASEH1 n/a
4 TRCN0000049787 GCTGCCAGATTTAAGAAGTTT pLKO.1 270 3UTR 100% 5.625 3.938 N RNASEH1 n/a
5 TRCN0000049783 GCCGTATGCAAAGCACATGAA pLKO.1 443 3UTR 100% 4.950 3.465 N RNASEH1 n/a
6 TRCN0000333357 GCCGTATGCAAAGCACATGAA pLKO_005 443 3UTR 100% 4.950 3.465 N RNASEH1 n/a
7 TRCN0000049784 GCTGACAGATTAGCCAGAGAA pLKO.1 924 3UTR 100% 4.950 3.465 N RNASEH1 n/a
8 TRCN0000049786 GCAAAGCCATTGAACAAGCAA pLKO.1 679 3UTR 100% 3.000 2.100 N RNASEH1 n/a
9 TRCN0000291902 GCAAAGCCATTGAACAAGCAA pLKO_005 679 3UTR 100% 3.000 2.100 N RNASEH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.