Transcript: Human XR_922837.2

PREDICTED: Homo sapiens collagen type IV alpha 4 chain (COL4A4), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL4A4 (1286)
Length:
5693
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922837.2
NBCI Gene record:
COL4A4 (1286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117186 CCCTGGTCACTTATACTCATT pLKO.1 393 3UTR 100% 4.950 6.930 N COL4A4 n/a
2 TRCN0000117183 CCCAGGATCAAGTGTGATATA pLKO.1 1682 3UTR 100% 13.200 9.240 N COL4A4 n/a
3 TRCN0000419925 TTGGAGATCCTGGGCTATTTG pLKO_005 1318 3UTR 100% 13.200 9.240 N COL4A4 n/a
4 TRCN0000117185 CCAGGAGTGAATGGTCAGAAA pLKO.1 2574 3UTR 100% 4.950 3.465 N COL4A4 n/a
5 TRCN0000117184 CCAGGATTAAAGGGAGAACTA pLKO.1 1290 3UTR 100% 4.950 3.465 N COL4A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.