Transcript: Human XR_928328.1

PREDICTED: Homo sapiens spermatogenesis and centriole associated 1 (SPATC1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATC1 (375686)
Length:
1745
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_928328.1
NBCI Gene record:
SPATC1 (375686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_928328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180287 CCCTTCCCGAATGCATAATTC pLKO.1 1194 3UTR 100% 13.200 18.480 N SPATC1 n/a
2 TRCN0000242489 AGAAGTTGGTGCGGCTCATTC pLKO_005 176 3UTR 100% 10.800 7.560 N SPATC1 n/a
3 TRCN0000242490 TTTCCTCACGCCAGAACAATG pLKO_005 293 3UTR 100% 10.800 7.560 N SPATC1 n/a
4 TRCN0000242488 AGCGCTATGTGAGCGTCATGA pLKO_005 1719 3UTR 100% 4.950 3.465 N SPATC1 n/a
5 TRCN0000181048 CTCCAACATCCCAGAGAAGAT pLKO.1 1521 3UTR 100% 4.950 3.465 N SPATC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_928328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.