Transcript: Human XR_928352.3

PREDICTED: Homo sapiens NIPA like domain containing 2 (NIPAL2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NIPAL2 (79815)
Length:
996
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_928352.3
NBCI Gene record:
NIPAL2 (79815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_928352.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412407 AGCCTCATTGACTGTTATTTC pLKO_005 908 3UTR 100% 13.200 9.240 N NIPAL2 n/a
2 TRCN0000121588 CAGCAAGAACAGTACAGTATT pLKO.1 600 3UTR 100% 13.200 9.240 N NIPAL2 n/a
3 TRCN0000418695 GAAACTTGGTGATCAGTATTT pLKO_005 264 3UTR 100% 13.200 9.240 N NIPAL2 n/a
4 TRCN0000121663 GTAGTGCCATTATTTCTGTTA pLKO.1 471 3UTR 100% 4.950 3.465 N NIPAL2 n/a
5 TRCN0000412982 GGCATTTGCAGGAACATATTT pLKO_005 541 3UTR 100% 15.000 9.000 N NIPAL2 n/a
6 TRCN0000122033 GCAGTTCCTGATCTATGTGAT pLKO.1 634 3UTR 100% 4.950 6.930 N NIPAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_928352.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.