Transcript: Human XR_929721.3

PREDICTED: Homo sapiens tubulin tyrosine ligase like 11 (TTLL11), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL11 (158135)
Length:
1879
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929721.3
NBCI Gene record:
TTLL11 (158135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929721.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426944 ATGACGGAGATGGTGCGTAAA pLKO_005 716 3UTR 100% 10.800 15.120 N TTLL11 n/a
2 TRCN0000417137 CCGGTCAAGTGAACAAGTTTC pLKO_005 690 3UTR 100% 10.800 15.120 N TTLL11 n/a
3 TRCN0000426418 GAGTTTCATTTCACGACAATG pLKO_005 660 3UTR 100% 10.800 15.120 N TTLL11 n/a
4 TRCN0000251531 TACTGGCATGGAGTTTCATTT pLKO_005 650 3UTR 100% 13.200 10.560 N Ttll11 n/a
5 TRCN0000419648 ATCATCTCCGTGGTGATTAAG pLKO_005 1319 3UTR 100% 13.200 9.240 N TTLL11 n/a
6 TRCN0000147091 CTTATCGACAAGCTCAAGTTT pLKO.1 1022 3UTR 100% 5.625 3.938 N TTLL11 n/a
7 TRCN0000148537 CACCGCATCTTTATGCACTTA pLKO.1 1160 3UTR 100% 4.950 3.465 N TTLL11 n/a
8 TRCN0000147864 GCTCAAGTTTGATATTCGTCT pLKO.1 1033 3UTR 100% 2.640 1.848 N TTLL11 n/a
9 TRCN0000148156 GTATGTCTTACTCAAGTCCTT pLKO.1 1054 3UTR 100% 2.640 1.848 N TTLL11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929721.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.