Transcript: Human XR_929791.3

PREDICTED: Homo sapiens patatin like phospholipase domain containing 7 (PNPLA7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNPLA7 (375775)
Length:
4897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929791.3
NBCI Gene record:
PNPLA7 (375775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428316 GGCGAAGAAGAGCGGCTTAAA pLKO_005 1261 3UTR 100% 13.200 18.480 N PNPLA7 n/a
2 TRCN0000430455 AGGACCAAGGTGCTGTCTTTG pLKO_005 568 3UTR 100% 10.800 15.120 N PNPLA7 n/a
3 TRCN0000436534 CAAGAGGATTCTGCGTTTCAA pLKO_005 591 3UTR 100% 5.625 7.875 N PNPLA7 n/a
4 TRCN0000416965 CATGTCCCTGTCCGGTTACAT pLKO_005 3489 3UTR 100% 5.625 7.875 N PNPLA7 n/a
5 TRCN0000435005 GGCCATGCTGCACCTTACAAA pLKO_005 979 3UTR 100% 5.625 7.875 N PNPLA7 n/a
6 TRCN0000180358 GCCTTCCATTCGCAAACAGAT pLKO.1 1383 3UTR 100% 4.950 6.930 N PNPLA7 n/a
7 TRCN0000426364 TCAGAAGGCTTAGACAATTTC pLKO_005 404 3UTR 100% 13.200 9.240 N PNPLA7 n/a
8 TRCN0000148622 CGAAATTGTGTCTCGCATTGA pLKO.1 4029 3UTR 100% 4.950 3.465 N PNPLA7 n/a
9 TRCN0000147672 GAAAGTCAAGGTGTTGAACAT pLKO.1 3717 3UTR 100% 4.950 3.465 N PNPLA7 n/a
10 TRCN0000149725 GATTCATCTCTTGGGTGAGAA pLKO.1 2376 3UTR 100% 4.950 3.465 N PNPLA7 n/a
11 TRCN0000147593 GAAGAGAGACAAAGTGATGTT pLKO.1 459 3UTR 100% 4.950 2.970 N PNPLA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.