Transcript: Human XR_931282.2

PREDICTED: Homo sapiens CD163 molecule like 1 (CD163L1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD163L1 (283316)
Length:
8838
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931282.2
NBCI Gene record:
CD163L1 (283316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436130 GAGTTGTCTGTTCCCGATATA pLKO_005 2698 3UTR 100% 13.200 18.480 N CD163L1 n/a
2 TRCN0000063240 CCCATCTTCTATCATTGGCAT pLKO.1 1904 3UTR 100% 2.640 2.112 N CD163L1 n/a
3 TRCN0000174116 CCCATCTTCTATCATTGGCAT pLKO.1 1904 3UTR 100% 2.640 2.112 N CD163L1 n/a
4 TRCN0000063241 CGTCGTGCTAAACCTAGTAAT pLKO.1 1284 3UTR 100% 13.200 9.240 N CD163L1 n/a
5 TRCN0000415753 GATGTCCGTTCAGCGTCTTTG pLKO_005 1258 3UTR 100% 10.800 7.560 N CD163L1 n/a
6 TRCN0000063239 GCTGCTGTCATCAGAACCTTT pLKO.1 70 3UTR 100% 4.950 3.465 N CD163L1 n/a
7 TRCN0000063242 CCCTCAGAGTTTCAACCAGAA pLKO.1 4201 3UTR 100% 4.050 2.835 N CD163L1 n/a
8 TRCN0000433470 GACATTCCGGAACCGTCAATT pLKO_005 1051 3UTR 100% 13.200 7.920 N CD163L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931282.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.