Transcript: Human XR_932837.3

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 6 (ABCC6), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC6 (368)
Length:
3952
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_932837.3
NBCI Gene record:
ABCC6 (368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_932837.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271320 AGATCGAGTTCCGGGACTTTG pLKO_005 3772 3UTR 100% 10.800 15.120 N ABCC6 n/a
2 TRCN0000059715 GTGGCCGAGAATGCTATGAAT pLKO.1 1850 3UTR 100% 5.625 4.500 N ABCC6 n/a
3 TRCN0000059716 CCACAGAATAAACCTCACGGT pLKO.1 2119 3UTR 100% 0.660 0.528 N ABCC6 n/a
4 TRCN0000284369 CCCAGGCTGATTGGATCATAG pLKO_005 2634 3UTR 100% 10.800 7.560 N ABCC6 n/a
5 TRCN0000271321 CCCATTGGTCACCTGCTAAAC pLKO_005 3299 3UTR 100% 10.800 7.560 N ABCC6 n/a
6 TRCN0000271257 TCGTGGTCTGCTTCGTCTATC pLKO_005 1491 3UTR 100% 10.800 7.560 N ABCC6 n/a
7 TRCN0000059714 CGATCTCCCATCAGCTTCTTT pLKO.1 3269 3UTR 100% 5.625 3.938 N ABCC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_932837.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.