Transcript: Human XR_933928.2

PREDICTED: Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase like 1 (B3GNTL1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B3GNTL1 (146712)
Length:
1556
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_933928.2
NBCI Gene record:
B3GNTL1 (146712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_933928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180239 CGAACGATACACACGTTGGAT pLKO.1 498 3UTR 100% 3.000 4.200 N B3GNTL1 n/a
2 TRCN0000149217 GACGAATGTTTGAGGTCTGTT pLKO.1 148 3UTR 100% 4.950 3.465 N B3GNTL1 n/a
3 TRCN0000148701 CAATGATGCCAGTAAGGACAA pLKO.1 210 3UTR 100% 4.050 2.835 N B3GNTL1 n/a
4 TRCN0000149797 GAACAAGATCAGGAAAGGCTT pLKO.1 936 3UTR 100% 2.640 1.848 N B3GNTL1 n/a
5 TRCN0000180633 CACGTGTCTATTATCCTCCCA pLKO.1 103 3UTR 100% 0.660 0.462 N B3GNTL1 n/a
6 TRCN0000149897 GACGAGAACAAGATCAGGAAA pLKO.1 931 3UTR 100% 4.950 2.970 N B3GNTL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_933928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.