Transcript: Human XR_933973.2

PREDICTED: Homo sapiens WD repeat domain 81 (WDR81), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR81 (124997)
Length:
6823
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_933973.2
NBCI Gene record:
WDR81 (124997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_933973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139828 CTCCTAGCAAGCAGGAAGTTA pLKO.1 6157 3UTR 100% 5.625 3.938 N WDR81 n/a
2 TRCN0000121811 GAACAGAAGATCCTCCTTGAT pLKO.1 3801 3UTR 100% 4.950 3.465 N WDR81 n/a
3 TRCN0000140892 GAAGCGTTGCTACCTTCACTT pLKO.1 6188 3UTR 100% 4.950 3.465 N WDR81 n/a
4 TRCN0000140581 GACGCTGACTCAGAAGATCAT pLKO.1 4190 3UTR 100% 4.950 3.465 N WDR81 n/a
5 TRCN0000143200 GTCAGAAGGCAAAGAACAGAA pLKO.1 3788 3UTR 100% 4.950 3.465 N WDR81 n/a
6 TRCN0000143326 GACTCAGAAGATCATCGTGTA pLKO.1 4196 3UTR 100% 4.050 2.835 N WDR81 n/a
7 TRCN0000140785 GAAGCTCAGCTCTGAGAACTT pLKO.1 5812 3UTR 100% 4.950 2.970 N WDR81 n/a
8 TRCN0000346502 CGCCATGCATACCACACTTAT pLKO_005 606 3UTR 100% 13.200 9.240 N Wdr81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_933973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.