Transcript: Human XR_934624.1

PREDICTED: Homo sapiens pleckstrin homology and RUN domain containing M1 (PLEKHM1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHM1 (9842)
Length:
5338
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934624.1
NBCI Gene record:
PLEKHM1 (9842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330739 CCGGTCTCTGCAAGAGGTATT pLKO_005 1074 3UTR 100% 10.800 15.120 N PLEKHM1 n/a
2 TRCN0000159996 CAAACACATCATCTCAGAGTT pLKO.1 459 3UTR 100% 4.950 6.930 N PLEKHM1 n/a
3 TRCN0000137480 GAAAGGTAGTGCCCACACTAT pLKO.1 5178 3UTR 100% 0.495 0.693 N PLEKHM1 n/a
4 TRCN0000330817 CCTACAAGTCTGCCATCTTAA pLKO_005 701 3UTR 100% 13.200 9.240 N PLEKHM1 n/a
5 TRCN0000330824 TACGTGAGTCACCCATGAAAT pLKO_005 3822 3UTR 100% 13.200 9.240 N PLEKHM1 n/a
6 TRCN0000330748 TGGTCTGAAGCTGGTAGTTTC pLKO_005 1437 3UTR 100% 10.800 7.560 N PLEKHM1 n/a
7 TRCN0000163625 GCCAGTGCTTTCAGATGCATT pLKO.1 5132 3UTR 100% 4.950 3.465 N PLEKHM1 n/a
8 TRCN0000162327 CCTGAAGTTTCTGACACAGAT pLKO.1 2823 3UTR 100% 4.950 2.970 N PLEKHM1 n/a
9 TRCN0000275747 AGGACCTGGATGCCCTATATA pLKO_005 2251 3UTR 100% 15.000 7.500 Y PLEKHM1 n/a
10 TRCN0000275801 GCCTTCTCTGGCCTCTATTAC pLKO_005 2710 3UTR 100% 13.200 6.600 Y PLEKHM1 n/a
11 TRCN0000134245 CATCAGGAACAATGAGAAGAT pLKO.1 2307 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
12 TRCN0000275803 CATCAGGAACAATGAGAAGAT pLKO_005 2307 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
13 TRCN0000164055 CCGCATCAGGAACAATGAGAA pLKO.1 2304 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
14 TRCN0000353699 CCGCATCAGGAACAATGAGAA pLKO_005 2304 3UTR 100% 4.950 2.475 Y PLEKHM1 n/a
15 TRCN0000135182 CCTAAACTCTGATAGCTGCTT pLKO.1 960 3UTR 100% 2.640 1.320 Y PLEKHM1 n/a
16 TRCN0000345638 TCAGCAAAGCCCAGGTAAATT pLKO_005 1103 3UTR 100% 15.000 10.500 N Plekhm1 n/a
17 TRCN0000345633 AGCTGTCCTGCAGCCTAAATT pLKO_005 947 3UTR 100% 15.000 7.500 Y Plekhm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934624.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.