Transcript: Human XR_935209.3

PREDICTED: Homo sapiens abhydrolase domain containing 3 (ABHD3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABHD3 (171586)
Length:
2002
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_935209.3
NBCI Gene record:
ABHD3 (171586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_935209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005387 GCCAAGACAGTCCACTTACAT pLKO.1 1231 3UTR 100% 5.625 7.875 N ABHD3 n/a
2 TRCN0000342660 GCCAAGACAGTCCACTTACAT pLKO_005 1231 3UTR 100% 5.625 7.875 N ABHD3 n/a
3 TRCN0000005386 CGTCGCTTATGCCTTCTACTA pLKO.1 251 3UTR 100% 4.950 6.930 N ABHD3 n/a
4 TRCN0000342722 CGTCGCTTATGCCTTCTACTA pLKO_005 251 3UTR 100% 4.950 6.930 N ABHD3 n/a
5 TRCN0000005385 GCGATTCACTTCAGTCATGTT pLKO.1 1000 3UTR 100% 4.950 6.930 N ABHD3 n/a
6 TRCN0000352717 GCGATTCACTTCAGTCATGTT pLKO_005 1000 3UTR 100% 4.950 6.930 N ABHD3 n/a
7 TRCN0000005388 GCCTTCAGTCTTCAGTTAATA pLKO.1 903 3UTR 100% 15.000 10.500 N ABHD3 n/a
8 TRCN0000005384 GCAACAAAGTTAGACTGACTT pLKO.1 1839 3UTR 100% 4.950 3.465 N ABHD3 n/a
9 TRCN0000342661 GCAACAAAGTTAGACTGACTT pLKO_005 1839 3UTR 100% 4.950 3.465 N ABHD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_935209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.