Transcript: Human XR_936510.2

PREDICTED: Homo sapiens DNA methyltransferase 3 beta (DNMT3B), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNMT3B (1789)
Length:
2395
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936510.2
NBCI Gene record:
DNMT3B (1789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364152 AGCTGTCCGAACTCGAAATAA pLKO_005 486 3UTR 100% 15.000 21.000 N DNMT3B n/a
2 TRCN0000424360 GACGATGGCTATCAGTCTTAC pLKO_005 1389 3UTR 100% 10.800 15.120 N DNMT3B n/a
3 TRCN0000035684 GCCTCAAGACAAATTGCTATA pLKO.1 1171 3UTR 100% 10.800 15.120 N DNMT3B n/a
4 TRCN0000035685 GCCCGTGATAGCATCAAAGAA pLKO.1 2210 3UTR 100% 5.625 7.875 N DNMT3B n/a
5 TRCN0000419070 TCACGGTTCCTGGAGTGTAAT pLKO_005 2109 3UTR 100% 13.200 10.560 N DNMT3B n/a
6 TRCN0000364153 CAATAGGATAGCCAAGTTAAA pLKO_005 2264 3UTR 100% 13.200 9.240 N DNMT3B n/a
7 TRCN0000035686 CCATGCAACGATCTCTCAAAT pLKO.1 1926 3UTR 100% 13.200 9.240 N DNMT3B n/a
8 TRCN0000035688 CCTGTCATTGTTTGATGGCAT pLKO.1 1709 3UTR 100% 2.640 1.848 N DNMT3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.