Transcript: Human XR_936602.3

PREDICTED: Homo sapiens zinc finger protein 335 (ZNF335), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF335 (63925)
Length:
4840
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936602.3
NBCI Gene record:
ZNF335 (63925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152695 GAGGAGGATAGCGACTATAAT pLKO.1 1443 3UTR 100% 15.000 21.000 N ZNF335 n/a
2 TRCN0000426458 GAAATACCGCAAGTACTATTA pLKO_005 1835 3UTR 100% 13.200 18.480 N ZNF335 n/a
3 TRCN0000420350 AGATCACACACATCCAGTATG pLKO_005 4278 3UTR 100% 10.800 7.560 N ZNF335 n/a
4 TRCN0000424263 GGTTGTGAGTGACACCCTAAA pLKO_005 3247 3UTR 100% 10.800 7.560 N ZNF335 n/a
5 TRCN0000154712 GATAGCCAGCATCCTCTCATT pLKO.1 4644 3UTR 100% 4.950 3.465 N ZNF335 n/a
6 TRCN0000155444 GCACATGCTGACTCACACAAA pLKO.1 3787 3UTR 100% 4.950 3.465 N ZNF335 n/a
7 TRCN0000154105 CAGTATATCATCTCCCAGGAT pLKO.1 4184 3UTR 100% 2.640 1.848 N ZNF335 n/a
8 TRCN0000153608 CCTCTTCATTTAGGATCTCCA pLKO.1 4616 3UTR 100% 2.640 1.848 N ZNF335 n/a
9 TRCN0000242189 GCATCGAGTACGACGTCATTA pLKO_005 4503 3UTR 100% 13.200 18.480 N Zfp335 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.