Transcript: Human XR_940389.2

PREDICTED: Homo sapiens chromosome 3 open reading frame 67 (C3orf67), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf67 (200844)
Length:
2897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940389.2
NBCI Gene record:
C3orf67 (200844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168113 CGGTAGCTCTTCAGGAAATAA pLKO.1 1548 3UTR 100% 15.000 21.000 N C3orf67 n/a
2 TRCN0000422220 ACGGAAGATCTTCACCTTAAA pLKO_005 912 3UTR 100% 13.200 18.480 N C3orf67 n/a
3 TRCN0000167352 CAGAAGAAGATTACGGTTAAA pLKO.1 1494 3UTR 100% 13.200 18.480 N C3orf67 n/a
4 TRCN0000420265 GATGAGCCTACAGATATTATA pLKO_005 991 3UTR 100% 15.000 10.500 N C3orf67 n/a
5 TRCN0000166895 CAGAATCAGATCAGTTCATTA pLKO.1 1121 3UTR 100% 13.200 9.240 N C3orf67 n/a
6 TRCN0000421223 GATGTTTGTCATATCGCATTT pLKO_005 1180 3UTR 100% 10.800 7.560 N C3orf67 n/a
7 TRCN0000167777 GATCAATCAGATGAGTGGATT pLKO.1 1663 3UTR 100% 4.950 3.465 N C3orf67 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.