Transcript: Human XR_940527.2

PREDICTED: Homo sapiens DLEC1 cilia and flagella associated protein (DLEC1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLEC1 (9940)
Length:
4332
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940527.2
NBCI Gene record:
DLEC1 (9940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038721 CCAGAAGATTACTACACCGAT pLKO.1 1256 3UTR 100% 2.640 3.696 N DLEC1 n/a
2 TRCN0000038720 CCAGTTTATGAGATGGTAATT pLKO.1 1793 3UTR 100% 13.200 9.240 N DLEC1 n/a
3 TRCN0000038723 GCTTTGTTGAACAACCTCCTT pLKO.1 2220 3UTR 100% 2.640 1.848 N DLEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.