Transcript: Human XR_942190.2

PREDICTED: Homo sapiens double C2 domain beta (DOC2B), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOC2B (8447)
Length:
1613
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_942190.2
NBCI Gene record:
DOC2B (8447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_942190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415596 AGGACAAATTCCGGCACAATG pLKO_005 700 3UTR 100% 10.800 15.120 N DOC2B n/a
2 TRCN0000158338 CAAGCAGATCTCCGACTACTT pLKO.1 134 3UTR 100% 4.950 6.930 N DOC2B n/a
3 TRCN0000157317 CTCACTTACTACGGGATCACA pLKO.1 633 3UTR 100% 3.000 4.200 N DOC2B n/a
4 TRCN0000421110 GAACGAGACCCTCACTTACTA pLKO_005 623 3UTR 100% 5.625 3.938 N DOC2B n/a
5 TRCN0000156833 GCTGTATGACCAGGAGAACAA pLKO.1 446 3UTR 100% 4.950 3.465 N DOC2B n/a
6 TRCN0000022743 CCTCAAGTACAGCTCACAGAA pLKO.1 863 3UTR 100% 4.950 2.970 N Doc2b n/a
7 TRCN0000157757 CGGGATCACAGATGAAGACAT pLKO.1 644 3UTR 100% 4.950 2.970 N DOC2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_942190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.