Transcript: Human XR_943403.2

PREDICTED: Homo sapiens TOG array regulator of axonemal microtubules 1 (TOGARAM1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOGARAM1 (23116)
Length:
3818
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_943403.2
NBCI Gene record:
TOGARAM1 (23116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_943403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428459 GGAGCTGCATTCACGATTATT pLKO_005 1262 3UTR 100% 15.000 21.000 N TOGARAM1 n/a
2 TRCN0000422175 ATCTTCCCGACGAGGTCTAAA pLKO_005 2906 3UTR 100% 13.200 18.480 N TOGARAM1 n/a
3 TRCN0000148362 CCTCAACTAGTTGTCTCGTTA pLKO.1 747 3UTR 100% 0.000 0.000 N TOGARAM1 n/a
4 TRCN0000427886 GAACCACCATCAGGGATTTAT pLKO_005 3694 3UTR 100% 15.000 10.500 N TOGARAM1 n/a
5 TRCN0000420672 AGTTCTTGGGACCAGTTATAG pLKO_005 1495 3UTR 100% 13.200 9.240 N TOGARAM1 n/a
6 TRCN0000147606 GCCAAGAATCATTGACTTCTT pLKO.1 3286 3UTR 100% 0.495 0.347 N TOGARAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_943403.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.