Transcript: Human XR_944836.3

PREDICTED: Homo sapiens BICD family like cargo adaptor 1 (BICDL1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BICDL1 (92558)
Length:
2013
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944836.3
NBCI Gene record:
BICDL1 (92558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436798 TGCGGGAAGCAGATCGAGAAA pLKO_005 617 3UTR 100% 4.950 3.960 N BICDL1 n/a
2 TRCN0000155513 CCAAAGGCTATTGGATCAGCT pLKO.1 672 3UTR 100% 2.640 2.112 N BICDL1 n/a
3 TRCN0000423601 ATGAATTGAGAAGACGATTTG pLKO_005 503 3UTR 100% 10.800 7.560 N BICDL1 n/a
4 TRCN0000434553 GCCAAGTGCAGGATGGATATG pLKO_005 1675 3UTR 100% 10.800 7.560 N BICDL1 n/a
5 TRCN0000155216 GCATAAGGAGCTGACAGACAA pLKO.1 456 3UTR 100% 4.950 3.465 N BICDL1 n/a
6 TRCN0000156092 CGGAACAGAACCAAAGGCTAT pLKO.1 662 3UTR 100% 4.050 2.835 N BICDL1 n/a
7 TRCN0000156190 CTCATCAACCAACCAGCACAT pLKO.1 768 3UTR 100% 4.050 2.835 N BICDL1 n/a
8 TRCN0000155289 GAGAGTGATGTGAAGCAGCTA pLKO.1 565 3UTR 100% 2.640 1.848 N BICDL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.