Transcript: Human XR_946567.2

PREDICTED: Homo sapiens argonaute RISC component 4 (AGO4), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO4 (192670)
Length:
1980
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946567.2
NBCI Gene record:
AGO4 (192670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007873 CGGCACTTCAAGATGCAAATA pLKO.1 294 3UTR 100% 13.200 18.480 N AGO4 n/a
2 TRCN0000231977 TCGACTGTTAGCCAATCATTT pLKO_005 170 3UTR 100% 13.200 18.480 N AGO4 n/a
3 TRCN0000415126 TCGACTGTTAGCCAATCATTT pLKO_005 170 3UTR 100% 13.200 18.480 N Ago4 n/a
4 TRCN0000231979 CAATATGGAGGCCGGAATAAA pLKO_005 1317 3UTR 100% 15.000 10.500 N AGO4 n/a
5 TRCN0000231978 TCACTATGATGTGGATATTAA pLKO_005 221 3UTR 100% 15.000 10.500 N AGO4 n/a
6 TRCN0000007874 GCCTACAGCTAATAGTGGTTA pLKO.1 1603 3UTR 100% 4.950 3.465 N AGO4 n/a
7 TRCN0000007875 CCTCAGAAACAATGTAGGGAA pLKO.1 1434 3UTR 100% 2.640 1.848 N AGO4 n/a
8 TRCN0000011205 CCAGCACCAATGCTGCAATAT pLKO.1 1302 3UTR 100% 1.320 0.924 N AGO4 n/a
9 TRCN0000164834 CAAACTCCTGAGCTCAAGCAA pLKO.1 1843 3UTR 100% 3.000 1.500 Y LINC00336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.