Transcript: Human XR_949378.3

PREDICTED: Homo sapiens establishment of sister chromatid cohesion N-acetyltransferase 2 (ESCO2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESCO2 (157570)
Length:
3096
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949378.3
NBCI Gene record:
ESCO2 (157570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416815 ATCTGTTTCCATCACCTAATA pLKO_005 158 3UTR 100% 13.200 9.240 N ESCO2 n/a
2 TRCN0000134753 GCAAGTCTTGTGGTATGATAT pLKO.1 1250 3UTR 100% 13.200 9.240 N ESCO2 n/a
3 TRCN0000138044 CCACAGGTTTCTGGAAGGAAT pLKO.1 1317 3UTR 100% 4.950 3.465 N ESCO2 n/a
4 TRCN0000134063 GTTGGGTGTTTAATTGCAGAA pLKO.1 1549 3UTR 100% 4.050 2.835 N ESCO2 n/a
5 TRCN0000136946 CCTGAAGATGAAATGCAGCAT pLKO.1 1285 3UTR 100% 2.640 1.584 N ESCO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.