Transcript: Human XR_949727.2

PREDICTED: Homo sapiens N-acetylated alpha-linked acidic dipeptidase like 1 (NAALADL1), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAALADL1 (10004)
Length:
2151
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949727.2
NBCI Gene record:
NAALADL1 (10004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073941 AGGCTCCTACTACGAGTATTT pLKO.1 1094 3UTR 100% 13.200 18.480 N NAALADL1 n/a
2 TRCN0000436493 TGTAACCTCAACGGAACTTTG pLKO_005 1242 3UTR 100% 10.800 15.120 N NAALADL1 n/a
3 TRCN0000073938 CCAGATGTGGTACAACCCTAT pLKO.1 786 3UTR 100% 4.050 5.670 N NAALADL1 n/a
4 TRCN0000073939 CCTCGCAGATCAATCGTGTTT pLKO.1 1566 3UTR 100% 4.950 3.960 N NAALADL1 n/a
5 TRCN0000073940 GATGCTCAATGACCAGTTGAT pLKO.1 2074 3UTR 100% 4.950 3.465 N NAALADL1 n/a
6 TRCN0000073942 GCATCAAACTTGAAGGCACCA pLKO.1 898 3UTR 100% 2.160 1.512 N NAALADL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.