Transcript: Human XR_950727.1

PREDICTED: Homo sapiens endoplasmic reticulum to nucleus signaling 2 (ERN2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERN2 (10595)
Length:
2351
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_950727.1
NBCI Gene record:
ERN2 (10595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_950727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195361 CGTCATCGAAGGACCAATGTA pLKO.1 265 3UTR 100% 5.625 7.875 N ERN2 n/a
2 TRCN0000021430 GCGTGTTCTACTACGTGCTTT pLKO.1 2324 3UTR 100% 4.950 6.930 N ERN2 n/a
3 TRCN0000021432 ACTGGCTTCTATGTCTCTAAA pLKO.1 944 3UTR 100% 13.200 9.240 N ERN2 n/a
4 TRCN0000195136 CTGGCTTCTATGTCTCTAAAG pLKO.1 945 3UTR 100% 10.800 7.560 N ERN2 n/a
5 TRCN0000021431 CCACCTGCACTCTTTACACAT pLKO.1 2070 3UTR 100% 4.950 3.465 N ERN2 n/a
6 TRCN0000195546 CTGCAGACTTTGCTCACATCT pLKO.1 1598 3UTR 100% 4.950 3.465 N ERN2 n/a
7 TRCN0000179143 GAAGGATGAAACTGGCTTCTA pLKO.1 934 3UTR 100% 4.950 3.465 N ERN2 n/a
8 TRCN0000147669 GAAGATTTCCTTCAATCCCAA pLKO.1 1740 3UTR 100% 2.640 1.848 N ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_950727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.