Transcript: turboGfp.1

Evrogen Turbo GFP

Taxon:
Control
Gene:
tGFP (tGFP)
Length:
695
CDS:
1..695

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to turboGfp.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?] Addgene[?]
1 TRCN0000223035 GCGTGATCTTCACCGACAAGA pLKO.1 395 CDS 100% 4.950 tGFP n/a
2 TRCN0000222866 GGACAGCCACATGCACTTCAA pLKO.1 531 CDS 100% 4.950 tGFP n/a
3 TRCN0000222901 ACCGACAAGATCATCCGCAGC pLKO.1 406 CDS 100% 0.400 tGFP n/a
4 TRCN0000222803 ACCTGCTGAGCCACGTGATGG pLKO.1 170 CDS 100% 0.000 tGFP n/a
5 TRCN0000222819 CGGCTACTACAGCTCCGTGGT pLKO.1 510 CDS 100% 0.000 tGFP n/a
6 TRCN0000222885 GCCACGTGATGGGCTACGGCT pLKO.1 179 CDS 100% 0.000 tGFP n/a
7 TRCN0000222796 TCCGTGGTGGACAGCCACATG pLKO.1 523 CDS 100% 0.000 tGFP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript turboGfp.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.